Review



scramble vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc scramble vector
    Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1060 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scramble vector/product/Addgene inc
    Average 96 stars, based on 1060 article reviews
    scramble vector - by Bioz Stars, 2026-05
    96/100 stars

    Images



    Similar Products

    scramble vector  (Addgene inc)
    96
    Addgene inc scramble vector
    Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scramble vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    scramble vector - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    shscramble vector  (Addgene inc)
    96
    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shscramble vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    shscramble vector - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    plko 1 scramble vector  (Addgene inc)
    96
    Addgene inc plko 1 scramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 scramble vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt  (Addgene inc)
    96
    Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    plko 1 scrambled control shrna vector  (Addgene inc)
    93
    Addgene inc plko 1 scrambled control shrna vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 scrambled control shrna vector/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    rna vector shctrl  (Addgene inc)
    96
    Addgene inc rna vector shctrl
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Rna Vector Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna vector shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    rna vector shctrl - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Journal: iScience

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    doi: 10.1016/j.isci.2025.114564

    Figure Lengend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Article Snippet: LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control.

    Techniques: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA